AssemblyQC is a Nextflow pipeline which evaluates assembly quality with well established tools and presents the results in a unified html report.
Reference:
Rashid, U., Wu, C., Shiller, J., Smith, K., Crowhurst, R., Davy, M., Chen, T.-H., Carvajal, I., Bailey, S., Thomson, S., & Deng, C.H. (2024). AssemblyQC: A Nextflow pipeline for reproducible reporting of assembly quality. Bioinformatics. DOI 10.1093/bioinformatics/btae477. GitHub https://github.com/Plant-Food-Research-Open/assemblyqc.
Only displaying parameters that differ from the pipeline defaults.
{
"Input/output options": {
"input": "https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/dev/assets/assemblysheetv2.csv",
"outdir": "results",
"tags": "plant-food-research-open,assemblyqc,test_full"
},
"General stats options": {
"gfastats_skip": "false"
},
"NCBI FCS options": {
"ncbi_fcs_adaptor_skip": "false",
"ncbi_fcs_adaptor_empire": "euk",
"ncbi_fcs_gx_skip": "false",
"ncbi_fcs_gx_tax_id": "35717",
"ncbi_fcs_gx_db_path": "/workspace/ComparativeDataSources/NCBI/FCS/GX/r2023-01-24"
},
"tidk options": {
"tidk_skip": "false",
"tidk_repeat_seq": "TTTGGG"
},
"BUSCO options": {
"busco_skip": "false",
"busco_mode": "genome",
"busco_lineage_datasets": "fungi_odb10 hypocreales_odb10"
},
"LAI options": {
"lai_skip": "false"
},
"Kraken 2 options": {
"kraken2_skip": "false",
"kraken2_db_path": "/workspace/ComparativeDataSources/kraken2db/k2_pluspfp_20240904"
},
"HiC options": {
"hic": "SRR8238190"
},
"Merqury options": {
"merqury_skip": "false"
},
"Synteny options": {
"synteny_skip": "false",
"synteny_mummer_skip": "false",
"synteny_plotsr_skip": "false",
"synteny_xref_assemblies": "https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/dev/assets/xrefsheet.csv"
},
"Institutional config options": {
"config_profile_name": "Plant&Food profile",
"config_profile_description": "Plant&Food profile using SLURM in combination with Apptainer"
},
"Generic options": {
"trace_report_suffix": "2025-09-23_12-35-07"
},
"Core Nextflow options": {
"runName": "cheesy_roentgen",
"containerEngine": "apptainer",
"launchDir": "/powerplant/workspace/hrauxr/assemblyqc",
"workDir": "/powerplant/workspace/hrauxr/assemblyqc/work",
"projectDir": "/powerplant/workspace/hrauxr/assemblyqc",
"userName": "hrauxr",
"profile": "pfr,apptainer,test_full",
"configFiles": "/workspace/hrauxr/.nextflow/config, /powerplant/workspace/hrauxr/assemblyqc/nextflow.config, /powerplant/workspace/hrauxr/assemblyqc/pfr/profile.config"
}
}
Following is a non-exhaustive list of tools used to generate this report.
{
"FCS-adaptor": "0.5.0",
"KronaTools": "2.7.1",
"LTR_FINDER_parallel": "v1.1",
"LTR_HARVEST_parallel": "v1.1",
"LTR_retriever": "v2.9.9",
"Nextflow": "24.10.6",
"assemblathon_stats": "github/PlantandFoodResearch/assemblathon2-analysis/a93cba2",
"awk": "1.3.4 20200120",
"biopython": 1.75,
"busco": "5.8.3",
"bwa": "0.7.18-r1243-dirty",
"circos": "v0.69-8",
"curl": "8.5.0",
"dnadiff": 1.3,
"fa-lint": "1.2.0",
"fastp": "0.24.0",
"fcs_gx": "0.5.5",
"genometools": "1.6.5",
"gfastats": "1.3.10",
"gffread": "0.12.7",
"grep": "(GNU grep) 3.4",
"gunzip": 1.13,
"hic_qc.py": "1.3.1",
"hictk": "hictk-v2.1.4-bioconda",
"juicebox_scripts": "0.1.0",
"kraken2": "2.1.2",
"lai": "beta3.2",
"ltr_finder": "v1.07",
"merqury": 1.3,
"meryl": "1.4.1",
"minimap2": "2.29-r1283",
"nucmer": "4.0.0rc1",
"pandas": "2.1.1",
"perl": "5.32.1",
"pigz": 2.6,
"plant-food-research-open/assemblyqc": "v3.0.0",
"plotly": "5.20.0",
"plotsr": "1.1.1",
"python": "3.10.2",
"samblaster": "0.1.26",
"samtools": "1.19.2",
"sed": "(GNU sed) 4.7",
"seqkit": "v2.9.0",
"sratools": "3.1.0",
"syri": "1.7.0",
"tidk": "0.2.41",
"ubuntu": "24.04.1l",
"yahs": "1.2.2"
}
FCS-adaptor detects adaptor and vector contamination in genome sequences.
Reference:
Version: 0.5.0
| Assembly | Contaminated? |
|---|---|
| FI1 | No |
No contamination detected.
FCS-GX detects contamination from foreign organisms in genome sequences.
Reference:
Alexander Astashyn, Eric S Tvedte, Deacon Sweeney, Victor Sapojnikov, Nathan Bouk, Victor Joukov, Eyal Mozes, Pooja K Strope, Pape M Sylla, Lukas Wagner, Shelby L Bidwell, Karen Clark, Emily W Davis, Brian Smith-White, Wratko Hlavina, Kim D Pruitt, Valerie A Schneider, Terence D Murphy bioRxiv 2023.06.02.543519; doi: 10.1101/2023.06.02.543519, GitHub: https://github.com/ncbi/fcs
Version: 0.5.5
DB Version: 2023-01-24
Note:
This report dynamically loads '*.fcs.gx.krona.html' files from the 'ncbi_fcs_gx' folder under the output directory. These files should also be moved when moving the report's HTML file.
| Assembly | Contaminated? |
|---|---|
| FI1 | No |
No contamination detected.
Bogus, Repeat, Low-coverage and Inconclusive results are labelled as No hits.
A script to calculate a basic set of metrics from a genome assembly.
Reference:
https://github.com/KorfLab/Assemblathon
Version: github/PlantandFoodResearch/assemblathon2-analysis/a93cba2
Warning:
Contig-related stats are based on the assumption that the assemblathon_stats_n_limit (100) parameter is specified correctly. If you are not certain of the value of the n_limit parameter, please ignore the contig-related stats.
| Stat | Value |
|---|---|
| Assembly | GCA_003814445.1_ASM381444v1_genomic.fna |
| Number of scaffolds | 8 |
| Total size of scaffolds | 35023690 |
| Longest scaffold | 7872678 |
| Shortest scaffold | 52960 |
| Number of scaffolds > 1K nt | 8 |
| Percentage of scaffolds > 1K nt | 100.0 |
| Number of scaffolds > 10K nt | 8 |
| Percentage of scaffolds > 10K nt | 100.0 |
| Number of scaffolds > 100K nt | 7 |
| Percentage of scaffolds > 100K nt | 87.5 |
| Number of scaffolds > 1M nt | 7 |
| Percentage of scaffolds > 1M nt | 87.5 |
| Number of scaffolds > 10M nt | 0 |
| Percentage of scaffolds > 10M nt | 0.0 |
| Mean scaffold size | 4377961 |
| Median scaffold size | 3434925 |
| N50 scaffold length | 6201951 |
| L50 scaffold count | 3 |
| scaffold %A | 28.15 |
| scaffold %C | 21.88 |
| scaffold %G | 21.83 |
| scaffold %T | 28.15 |
| scaffold %N | 0.0 |
| scaffold %non-ACGTN | 0.0 |
| Number of scaffold non-ACGTN nt | 0 |
| Percentage of assembly in scaffolded contigs | 0.0 |
| Percentage of assembly in unscaffolded contigs | 100.0 |
| Average number of contigs per scaffold | 1.0 |
| Mean length of breaks (>=100Ns) between contigs in scaffold | 0 |
| Number of contigs | 8 |
| Number of contigs in scaffolds | 0 |
| Number of contigs not in scaffolds | 8 |
| Total size of contigs | 35023690 |
| Longest contig | 7872678 |
| Shortest contig | 52960 |
| Number of contigs > 1K nt | 8 |
| Percentage of contigs > 1K nt | 100.0 |
| Number of contigs > 10K nt | 8 |
| Percentage of contigs > 10K nt | 100.0 |
| Number of contigs > 100K nt | 7 |
| Percentage of contigs > 100K nt | 87.5 |
| Number of contigs > 1M nt | 7 |
| Percentage of contigs > 1M nt | 87.5 |
| Number of contigs > 10M nt | 0 |
| Percentage of contigs > 10M nt | 0.0 |
| Mean contig size | 4377961 |
| Median contig size | 3434925 |
| N50 contig length | 6201951 |
| L50 contig count | 3 |
| contig %A | 28.15 |
| contig %C | 21.88 |
| contig %G | 21.83 |
| contig %T | 28.15 |
| contig %N | 0.0 |
| contig %non-ACGTN | 0.0 |
| Number of contig non-ACGTN nt | 0 |
A fast and exhaustive tool for summary statistics.
Reference:
Giulio Formenti, Linelle Abueg, Angelo Brajuka, Nadolina Brajuka, Cristóbal Gallardo-Alba, Alice Giani, Olivier Fedrigo, Erich D Jarvis, Gfastats: conversion, evaluation and manipulation of genome sequences using assembly graphs, Bioinformatics, Volume 38, Issue 17, September 2022, Pages 4214–4216, 10.1093/bioinformatics/btac460
Version: 1.3.10
| Stat | Value |
|---|---|
| Total scaffold length | 35023690 |
| Average scaffold length | 4377961.25 |
| Scaffold N50 | 6201951 |
| Scaffold auN | 5781567.55 |
| Scaffold L50 | 3 |
| Largest scaffold | 7872678 |
| Smallest scaffold | 52960 |
| # contigs | 8 |
| Total contig length | 35023690 |
| Average contig length | 4377961.25 |
| Contig N50 | 6201951 |
| Contig auN | 5781567.55 |
| Contig L50 | 3 |
| Largest contig | 7872678 |
| Smallest contig | 52960 |
| # gaps in scaffolds | 0 |
| Total gap length in scaffolds | 0 |
| Average gap length in scaffolds | 0.00 |
| Gap N50 in scaffolds | 0 |
| Gap auN in scaffolds | 0.00 |
| Gap L50 in scaffolds | 0 |
| Largest gap in scaffolds | 0 |
| Smallest gap in scaffolds | 0 |
| Base composition (A:C:G:T) | 9857662:7662657:7645812:9857559 |
| GC content % | 43.71 |
| # soft-masked bases | 10431104 |
| # segments | 8 |
| Total segment length | 35023690 |
| Average segment length | 4377961.25 |
| # gaps | 0 |
| # paths | 8 |
| Scaffold N10 | 7872678 |
| Scaffold N20 | 7872678 |
| Scaffold N30 | 7605136 |
| Scaffold N40 | 7605136 |
| Scaffold N50 | 6201951 |
| Scaffold N60 | 6201951 |
| Scaffold N70 | 3434925 |
| Scaffold N80 | 3417637 |
| Scaffold N90 | 3252422 |
| Scaffold N100 | 52960 |
| Scaffold L10 | 1 |
| Scaffold L20 | 1 |
| Scaffold L30 | 2 |
| Scaffold L40 | 2 |
| Scaffold L50 | 3 |
| Scaffold L60 | 3 |
| Scaffold L70 | 4 |
| Scaffold L80 | 5 |
| Scaffold L90 | 6 |
| Scaffold L100 | 8 |
| Contig N10 | 7872678 |
| Contig N20 | 7872678 |
| Contig N30 | 7605136 |
| Contig N40 | 7605136 |
| Contig N50 | 6201951 |
| Contig N60 | 6201951 |
| Contig N70 | 3434925 |
| Contig N80 | 3417637 |
| Contig N90 | 3252422 |
| Contig N100 | 52960 |
| Contig L10 | 1 |
| Contig L20 | 1 |
| Contig L30 | 2 |
| Contig L40 | 2 |
| Contig L50 | 3 |
| Contig L60 | 3 |
| Contig L70 | 4 |
| Contig L80 | 5 |
| Contig L90 | 6 |
| Contig L100 | 8 |
| Gap N10 | 0 |
| Gap N20 | 0 |
| Gap N30 | 0 |
| Gap N40 | 0 |
| Gap N50 | 0 |
| Gap N60 | 0 |
| Gap N70 | 0 |
| Gap N80 | 0 |
| Gap N90 | 0 |
| Gap N100 | 0 |
| Gap L10 | 0 |
| Gap L20 | 0 |
| Gap L30 | 0 |
| Gap L40 | 0 |
| Gap L50 | 0 |
| Gap L60 | 0 |
| Gap L70 | 0 |
| Gap L80 | 0 |
| Gap L90 | 0 |
| Gap L100 | 0 |
A tool to calculate a basic set of statistics about features contained in GFF3 files.
Reference:
Gremme G, Steinbiss S, Kurtz S. GenomeTools: a comprehensive software library for efficient processing of structured genome annotations. IEEE/ACM Trans Comput Biol Bioinform. 2013 May-Jun;10(3):645-56. doi: 10.1109/TCBB.2013.68. PMID: 24091398.
Version: 1.6.5
| Stat | Value |
|---|---|
| parsed genome node DAGs | 7165 |
| sequence regions | 8 (total length: 35023690) |
| multi-features | 5951 |
| genes | 7137 |
| protein-coding genes | 7034 |
| mRNAs | 7034 |
| protein-coding mRNAs | 7034 |
| exons | 20368 |
| CDSs | 20265 |
| introns | 13231 |
| rRNAs | 3 |
| regions | 8 |
| tRNAs | 98 |
| transcripts | 2 |
BUSCO estimates the completeness and redundancy of processed genomic data based on universal single-copy orthologs.
Reference:
Manni M., Berkeley M.R., Seppey M., Simao F.A., Zdobnov E.M. 2021. BUSCO update: novel and streamlined workflows along with broader and deeper phylogenetic coverage for scoring of eukaryotic, prokaryotic, and viral genomes. arXiv:2106.11799 [q-bio] [Internet]. Available from: arxiv.org/abs/2106.11799
Version: 5.8.3
| Assembly | Lineage | Percentages |
|---|---|---|
| FI1 | fungi_odb10 | C:98.4%[S:97.9%,D:0.5%],F:0.1%,M:1.5%,n:758 |
| FI1 | hypocreales_odb10 | C:96.3%[S:96.2%,D:0.1%],F:0.5%,M:3.2%,n:4494 |
| Event | Value |
|---|---|
| Search Percentages | C:98.4%[S:97.9%,D:0.5%],F:0.1%,M:1.5%,n:758 |
| Event | Frequency |
|---|---|
| Complete BUSCOs (C) | 746 |
| Complete and single-copy BUSCOs (S) | 742 |
| Complete and duplicated BUSCOs (D) | 4 |
| Fragmented BUSCOs (F) | 1 |
| Missing BUSCOs (M) | 11 |
| Total BUSCO groups searched | 758 |
| Parameter | Value |
|---|---|
| Version | 5.8.3 |
| Lineage create on | 2024-01-08 |
| mode | euk_genome_met |
| predictor | metaeuk |
| Dependency | Version |
|---|---|
| hmmsearch | 3.4 |
| bbtools | None |
| metaeuk | 7.bba0d80 |
| python | sys.version_info(major=3, minor=10, micro=16, releaselevel='final', serial=0) |
| Event | Value |
|---|---|
| Search Percentages | C:96.3%[S:96.2%,D:0.1%],F:0.5%,M:3.2%,n:4494 |
| Event | Frequency |
|---|---|
| Complete BUSCOs (C) | 4326 |
| Complete and single-copy BUSCOs (S) | 4322 |
| Complete and duplicated BUSCOs (D) | 4 |
| Fragmented BUSCOs (F) | 23 |
| Missing BUSCOs (M) | 145 |
| Total BUSCO groups searched | 4494 |
| Parameter | Value |
|---|---|
| Version | 5.8.3 |
| Lineage create on | 2024-01-08 |
| mode | euk_genome_met |
| predictor | metaeuk |
| Dependency | Version |
|---|---|
| hmmsearch | 3.4 |
| bbtools | None |
| metaeuk | 7.bba0d80 |
| python | sys.version_info(major=3, minor=10, micro=16, releaselevel='final', serial=0) |
BUSCO estimates the completeness and redundancy of processed genomic data based on universal single-copy orthologs. GFFREAD is used to obtain protein sequences from assembly FASTA and annotation GFF3 files.
Reference:
Manni M., Berkeley M.R., Seppey M., Simao F.A., Zdobnov E.M. 2021. BUSCO update: novel and streamlined workflows along with broader and deeper phylogenetic coverage for scoring of eukaryotic, prokaryotic, and viral genomes. arXiv:2106.11799 [q-bio] [Internet]. Available from: arxiv.org/abs/2106.11799
Pertea G, Pertea M. GFF Utilities: GffRead and GffCompare. F1000Res. 2020 Apr 28;9:ISCB Comm J-304. doi: 10.12688/f1000research.23297.2. PMID: 32489650; PMCID: PMC7222033.
Version: 5.8.3 (BUSCO), 0.12.7 (GFFREAD)
| Annotation | Lineage | Percentages |
|---|---|---|
| FI1 | fungi_odb10 | C:90.1%[S:89.6%,D:0.5%],F:0.7%,M:9.2%,n:758 |
| FI1 | hypocreales_odb10 | C:87.5%[S:87.4%,D:0.1%],F:0.6%,M:11.9%,n:4494 |
| Event | Value |
|---|---|
| Search Percentages | C:90.1%[S:89.6%,D:0.5%],F:0.7%,M:9.2%,n:758 |
| Event | Frequency |
|---|---|
| Complete BUSCOs (C) | 683 |
| Complete and single-copy BUSCOs (S) | 679 |
| Complete and duplicated BUSCOs (D) | 4 |
| Fragmented BUSCOs (F) | 5 |
| Missing BUSCOs (M) | 70 |
| Total BUSCO groups searched | 758 |
| Parameter | Value |
|---|---|
| Version | 5.8.3 |
| Lineage create on | 2024-01-08 |
| mode | proteins |
| predictor | None |
| Dependency | Version |
|---|---|
| hmmsearch | 3.4 |
| python | sys.version_info(major=3, minor=10, micro=16, releaselevel='final', serial=0) |
| Event | Value |
|---|---|
| Search Percentages | C:87.5%[S:87.4%,D:0.1%],F:0.6%,M:11.9%,n:4494 |
| Event | Frequency |
|---|---|
| Complete BUSCOs (C) | 3931 |
| Complete and single-copy BUSCOs (S) | 3927 |
| Complete and duplicated BUSCOs (D) | 4 |
| Fragmented BUSCOs (F) | 26 |
| Missing BUSCOs (M) | 537 |
| Total BUSCO groups searched | 4494 |
| Parameter | Value |
|---|---|
| Version | 5.8.3 |
| Lineage create on | 2024-01-08 |
| mode | proteins |
| predictor | None |
| Dependency | Version |
|---|---|
| hmmsearch | 3.4 |
| python | sys.version_info(major=3, minor=10, micro=16, releaselevel='final', serial=0) |
A toolkit to identify and visualise telomeric repeats for the Darwin Tree of Life genomes.
Reference:
https://github.com/tolkit/telomeric-identifier
Version: 0.2.41
Searched sequence: AACCCTAACCCTAACCCTAACCCT
Searched sequence: TTTGGG
LTR Assembly Index (LAI) is a reference-free genome metric that evaluates assembly continuity using LTR-RTs. LTR retrotransposons (LTR-RTs) are the predominant interspersed repeat that is poorly assembled in draft genomes. Correcting for LTR-RT amplification dynamics, LAI is independent of genome size, genomic LTR-RT content, and gene space evaluation metrics such as BUSCO. LAI = Raw LAI + 2.8138 × (94 – whole genome LTR identity). The LAI is set to 0 when raw LAI = 0 or the adjustment produces a negative value. Raw LAI = (Intact LTR element length / Total LTR sequence length) * 100
Reference:
Shujun Ou, Jinfeng Chen, Ning Jiang, Assessing genome assembly quality using the LTR Assembly Index (LAI), Nucleic Acids Research, Volume 46, Issue 21, 30 November 2018, Page e126, 10.1093/nar/gky730
Version: beta3.2
| Assembly | Results |
|---|---|
| FI1 | Intact: 0.0113, Total: 0.2065, Raw LAI: 5.50, LAI: 4.84 |
Kraken2 assigns taxonomic labels to sequencing reads for metagenomics projects.
Reference:
Wood, D.E., Lu, J. & Langmead, B. Improved metagenomic analysis with Kraken 2. Genome Biol 20, 257 (2019). 10.1186/s13059-019-1891-0
Version: 2.1.2
Note:
This report dynamically loads '*.kraken2.krona.html' files from the 'kraken2' folder under the output directory. These files should also be moved when moving the report's HTML file.
Hi-C contact mapping experiments measure the frequency of physical contact between loci in the genome. The resulting dataset, called a “contact map,” is represented using a two-dimensional heatmap where the intensity of each pixel indicates the frequency of contact between a pair of loci.
References:
fastp Chen, Yanqing Zhou, Yaru Chen, Jia Gu, fastp: an ultra-fast all-in-one FASTQ preprocessor, Bioinformatics, Volume 34, Issue 17, September 2018, Pages i884–i890, 10.1093/bioinformatics/bty560
BWA Li, H. (2013). Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv preprint arXiv: 1303.3997.
SAMBLASTER Gregory G. Faust, Ira M. Hall, SAMBLASTER: fast duplicate marking and structural variant read extraction, Bioinformatics, Volume 30, Issue 17, September 2014, Pages 2503–2505, 10.1093/bioinformatics/btu314
SAMtools Petr Danecek, James K Bonfield, Jennifer Liddle, John Marshall, Valeriu Ohan, Martin O Pollard, Andrew Whitwham, Thomas Keane, Shane A McCarthy, Robert M Davies, Heng Li, Twelve years of SAMtools and BCFtools, GigaScience, Volume 10, Issue 2, February 2021, giab008, 10.1093/gigascience/giab008
YaHS Chenxi Zhou, Shane A McCarthy, Richard Durbin, YaHS: yet another Hi-C scaffolding tool, Bioinformatics, Volume 39, Issue 1, January 2023, btac808, 10.1093/bioinformatics/btac808
hictk Roberto Rossini, Jonas Paulsen, hictk: blazing fast toolkit to work with .hic and .cool files Bioinformatics, Volume 40, Issue 7, July 2024, btae408, 10.1093/bioinformatics/btae408
Juicebox.js Robinson JT, Turner D, Durand NC, Thorvaldsdóttir H, Mesirov JP, Aiden EL. Juicebox.js Provides a Cloud-Based Visualization System for Hi-C Data. Cell Syst. 2018 Feb 28;6(2):256-258.e1. 10.1016/j.cels.2018.01.001. Epub 2018 Feb 7. PMID: 29428417; PMCID: PMC6047755.
Version: 2.4.3
Notes:
HiC QC report
fastp log
Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 26408294 total bases: 2112663520 Q20 bases: 2033771115(96.2657%) Q30 bases: 2001190936(94.7236%) Read2 before filtering: total reads: 26408294 total bases: 2112663520 Q20 bases: 1978972764(93.6719%) Q30 bases: 1933151999(91.5031%) Read1 after filtering: total reads: 25405615 total bases: 2031716126 Q20 bases: 1966130766(96.7719%) Q30 bases: 1937083561(95.3422%) Read2 after filtering: total reads: 25405615 total bases: 2031715879 Q20 bases: 1935938955(95.2859%) Q30 bases: 1897487240(93.3933%) Filtering result: reads passed filter: 50811230 reads failed due to low quality: 1584466 reads failed due to too many N: 22150 reads failed due to too short: 398742 reads with adapter trimmed: 723915 bases trimmed due to adapters: 37726206 Duplication rate: 7.78525% Insert size peak (evaluated by paired-end reads): 129 JSON report: SRR8238190.fastp.json HTML report: SRR8238190.fastp.html fastp --in1 SRR8238190_1.fastq.gz --in2 SRR8238190_2.fastq.gz --out1 SRR8238190_1.fastp.fastq.gz --out2 SRR8238190_2.fastp.fastq.gz --json SRR8238190.fastp.json --html SRR8238190.fastp.html --failed_out SRR8238190.paired.fail.fastq.gz --unpaired1 SRR8238190_1.fail.fastq.gz --unpaired2 SRR8238190_2.fail.fastq.gz --thread 6 --detect_adapter_for_pe --qualified_quality_phred 20 --length_required 50 fastp v0.24.0, time used: 70 seconds
Circos facilitates the identification and analysis of similarities and differences arising from comparisons of genomes. The genome-wide alignments are performed with MUMMER.
References:
Krzywinski, M., Schein, J., Birol, I., Connors, J., Gascoyne, R., Horsman, D., ... & Marra, M. A. (2009). Circos: an information aesthetic for comparative genomics. Genome research, 19(9), 1639-1645. 10.1101/gr.092759.109
Marçais G, Delcher AL, Phillippy AM, Coston R, Salzberg SL, Zimin A. MUMmer4: A fast and versatile genome alignment system. PLoS Comput Biol. 2018 Jan 26;14(1):e1005944. 10.1371/journal.pcbi.1005944
Versions: v0.69-8 (CIRCOS), 4.0.0rc1 (MUMMER)
Notes:
The genome-wide alignments are performed with MUMMER.
References:
Krzywinski, M., Schein, J., Birol, I., Connors, J., Gascoyne, R., Horsman, D., ... & Marra, M. A. (2009). Circos: an information aesthetic for comparative genomics. Genome research, 19(9), 1639-1645. https://doi.org/10.1101/gr.092759.109
Version: 4.0.0rc1 (MUMMER)
Notes:
Plotsr generates high-quality visualisation of synteny and structural rearrangements between multiple genomes. For this, it uses the genomic structural annotations between multiple chromosome-level assemblies. The genome-wide alignments are performed with Minimap2.
References:
Goel M, Schneeberger K. 2022. plotsr: visualizing structural similarities and rearrangements between multiple genomes. Bioinformatics. 2022 May 13;38(10):2922-2926. doi: 10.1093/bioinformatics/btac196. PMID: 35561173; PMCID: PMC9113368.
Goel M, Sun H, Jiao WB, Schneeberger K. 2019. SyRI: finding genomic rearrangements and local sequence differences from whole-genome assemblies. Genome Biol. 2019 Dec 16;20(1):277. doi: 10.1186/s13059-019-1911-0. PMID: 31842948; PMCID: PMC6913012.
Li H. 2021. New strategies to improve minimap2 alignment accuracy, Bioinformatics, Volume 37, Issue 23, December 2021, Pages 4572–4574, doi: 10.1093/bioinformatics/btab705
Versions: 1.1.1 (PLOTSR), 1.7.0 (SYRI), 2.29-r1283 (MINIMAP2)
Note:
This report dynamically loads '*.on.*.all/' folders from the 'synteny' folder under the output directory. These folders should also be moved when moving the report's HTML file.
Error: Syri failed to detect structural rearrangements for following comparisons: TT_2021a with reference to JAD. This may be due to known Syri limitations. See: GitHub/Syri/Limitations
Sequence labels
| Labels | JAD | TT_2021a | FI1 |
|---|---|---|---|
| Chr1 | JADWOS010000003.1 | CP083245.1 | CP031385.1 |
| Chr2 | JADWOS010000004.1 | CP083246.1 | CP031386.1 |
| Chr3 | JADWOS010000005.1 | CP083247.1 | CP031387.1 |
| Chr4 | JADWOS010000006.1 | CP083248.1 | CP031388.1 |
| Chr5 | JADWOS010000007.1 | CP083249.1 | CP031389.1 |
| Chr6 | JADWOS010000008.1 | CP083250.1 | CP031390.1 |
| Chr7 | JADWOS010000009.1 | CP083251.1 | CP031391.1 |
Often, genome assembly projects have illumina whole genome sequencing reads available for the assembled individual. The k-mer spectrum of this read set can be used for independently evaluating assembly quality without the need of a high quality reference. Merqury provides a set of tools for this purpose.
References:
Rhie, A., Walenz, B.P., Koren, S. et al. Merqury: reference-free quality, completeness, and phasing assessment for genome assemblies. Genome Biol 21, 245 (2020). doi: 10.1186/s13059-020-02134-9
Version: 1.3
Completeness stats
| Assembly | Region | Found | Total | % Covered |
|---|---|---|---|---|
| FI1 | all | 26653235 | 26743412 | 99.6628 |
Consensus quality QV stats
| Assembly | No Support | Total | QV | Error % |
|---|---|---|---|---|
| FI1 | 3468 | 35023530 | 53.2648 | 4.71542e-06 |
Spectra-asm
FI1 spectra-cn